About sequence notation:

Standard notation of DNA sequences is from 5’ to 3’.

So, primer sequence atgcgtccggcgtagag means 5’ atgcgtccggcgtagag 3’
and the direction of the sequence of plasmid vector pGT4 is in the following orientation:
5’ at the start to 3’ at the end of the sequence shown.
The restriction enzyme site GGATCC means 5' GGATCC 3' .

About primers and their direction in PCR:

The orientation of primers means: the direction in which the elongation of the primer in DNA synthesis occurs. Since DNA synthesis is always from 5' to 3' , the 3' ends of a PCR primer set point towards each other, when they are annealed to their template strand, and the primers anneal on opposite strands of the PCR template. In the picture above, the forward primer anneals to the template (-) strand, and is identical to (a part of) the template (+) strand. And the reverse primer anneals to the template (+) strand, and is identical to (a part of) the template (-) strand. Forward, reverse, (+) and (-) refer to transcription of genes: the (+) DNA strand has the same orientation as a messenger RNA, transcribed from the DNA. So the forward orientation is: pointing towards the end of a gene.

Restrictrion enzymes recognition sites nomenclature

Recognition sequences representations use the standard abbreviations to represent ambiguity:

                                      R = G or A
                        Y = C or T
                        M = A or C
                        K = G or T
                        S = G or C
                        W = A or T
                        B = not A (C or G or T)
                        D = not C (A or G or T)
                        H = not G (A or C or T)
                        V = not T (A or C or G)
                        N = A or C or G or T

Recognition sequences are written from 5' to 3', only one strand being given. If the point of cleavage has been determined, the precise site may be marked with ^. For enzymes such as HgaI, MboII etc., which cleave away from their recognition sequence the cleavage sites are indicated in parentheses.

For example HgaI GACGC (5/10) indicates cleavage as follows:

5' GACGCNNNNN^ 3'
3' CTGCGNNNNNNNNNN^ 5'

Typically, the recognition sequences are oriented so that the cleavage sites lie on their 3' side.

note:
Degeneracy: When more than one nucleotide is possible at a particular position in the recognition site of a restriction enzyme (ambiguity of recognition).

Reverse complement

Often we need to obtain the complementary strand of a DNA sequence. As DNA is antiparallel, we really need the reverse complement sequence to keep our 5' and 3' ends properly oriented. While this is easy to do manually with short sequences, for longer sequences computer programs (e.g. EMBOSS revseq) are easier.

Original Sequence 5'ATGCAGGGGAAACATGATTCAGGAC 3'
Complement 3'TACGTCCCCTTTGTACTAAGTCCTG 5'

(Complement Pairs with Original Sequence, antiparallel)

Reverse Complement 5'GTCCTGAATCATGTTTCCCCTGCAT 3'

(= Complement sequence written 5' to 3')

In a palindromic DNA sequence, the sequence is the same when one DNA strand is read left to right and the other strand is read right to left. So, the reverse complement of the palindromic sequence is the same sequence..
Recognition sites of many restriction enzymes are palindromic.